Skip to main content

Table 1 Primers used in this study

From: The identification of human aldo-keto reductase AKR7A2 as a novel cytoglobin-binding partner

Constructs Primer sequence (5′-3′)
pcDNA3.0-FLAG-CYGB F: AGCTTAGATTACAAGGATGACGACGATAAGATGGAGAAAG
  R: CGGAATTCCTACGGCCCCGAAGAGG
pGBKT7-CYGB F: CGGAATTCATGGAGACAGGCGAG
  R: AAAACTGCAGCTACGGCCCCGAAGAGG
pCMV-MYC-AKR7A2 F: CGAATTCAAATGCTGAGTGCCGCGTCT
  R: CCGACTCGAGCTAGCGGAAGTAGTTGGGA
pGADT7-AKR7A2 F: CGAATTCATGCTGAGTGCCGCGTCT
  R: CCGACTCGAGCTAGCGGAAGTAGTTGGGA