Skip to main content

Table 1 Primers for quantitative real time PCR

From: PPARγ agonist through the terminal differentiation phase is essential for adipogenic differentiation of fetal ovine preadipocytes

Gene Primer Length (bp) Accession number
oADIPOQ - Forward GGAGATCCAGGTCTCGTTGG 98 NM_001308565
oADIPOQ - Reverse TTTCTGCCTGGGACTCCTGG
oβ-ACTIN - Forward CCAACCGTGAGAAGATGACC 97 NM_001009784
oβ-ACTIN - Reverse CCAGAGGCGTACAGGGACAG
oC/EBPα - Forward CCCCGACAGGAGCAAGGT 114 KF830871
oC/EBPα - Reverse GGTTCAAAGCCCCAAGT
oDLK1 - Forward GGCATCGTCTTCCTCAAC 89 XM_015102053
oDLK1 - Reverse CGCAGCAGCAGATTCTTC
oFABP4 - Forward GGATGATAAGCTGGTGCTGG 53 NM_001114667.1
oFABP4 - Reverse CTCTGGTAGCAGTGACACCG
oGAPDH - Forward TTCCACGGCACAGTCAA 241 NM_001190390
oGAPDH - Reverse TCACGCCCATCACAAAC
mGAPDH - Forward CGGCAAATTCAACGGCACA 84 NM_001289726
mGAPDH - Reverse TCTCGCTCCTGGAAGATGG
oPPARγ - Forward TGGATGACCACTCCCATGCC 97 NM_001100921
oPPARγ - Reverse TTGGGAACGGAATGTCCTC
oRPL27 - Forward CGCAAGGCCCGACGAGAGGC 93 XM_015098799
oRPL27 - Reversr GACCTAAAACCGCAGCTTCTGG
oZFP423 - Forward CCCGATTCCAGCAACCACA 160 XM_015100428
oZFP423 - Reverse CGTCATCCCGCATCTTCTTCT
mZFP423 - Forward CCGTCTGCTTCACAGTCTTCG 155 NM_001310520
mZFP423 - Reverse TGCGTGCTGGCTCATCG
  1. Note: o refers to ovine, m refers to murine. Accession number from NCBI gene database