Skip to main content

Table 1 Sequence of primers used in this study

From: miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1

Name Sequence (5′ to 3′)
miR-378-RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACGCCTTC
U6-RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAAAATATGG
miR-378-Fwd TGCGGACTGGACTTGGAGTCAG
U6-Fwd TGCGGGTGCTCGCTTCGGCAGC
miRNA-Rvs CCAGTGCAGGGTCCGAGGT
SDAD1-Fwd AAAACAGTTGGCACTACGAG
SDAD1-Rvs CCTACCATTAGCCGTCTCC
β-actin-Fwd TTGCGTTACACCCTTTCTTG
β-actin-Rvs TGCTGTCACCTTCACCGTTC