Skip to main content

Table 1 Primer sequences for PCR

From: The suppressive effect of co-inhibiting PD-1 and CTLA-4 expression on H22 hepatomas in mice

Gene name Primer sequence
β-actin Sense: 5′-ATGGGTCAGAAGGACTCCTATG-3′
Antisense: 5′-ATCTCCTGCTCGAAGTCTAGAG-3′
PD-1 Sense: 5′-GCCTGGCTCACAGTGTCAG-3′
Antisense: 5′-TCCAGGGCTCTCCTCGATT − 3′
CTLA-4 Sense: GTCTTCTCTGAAGCCATACAG −3′
Antisense: 5′-GACCTCATCAGTGTTGTGTGA-3′
PD-L1 Sense: 5′-GGAATTGTCTCAGAATGGTC-3′
Antisense: 5′-GTAGTTGCTTCTAGGAAGGAG-3′
IFN-γ Sense: 5′-GCTTTGCAGCTCTTCCTCAT-3′
Antisense: 5′-GTCACCATCCTTTTGCCAGT-3′
IL-6 Sense: 5′-CTTAATTACACATGTTCTCTGGGAAA-3′
Antisense: 5′-CAAGTGCATCATCGTTGTTCATAC-3′