Skip to main content

Table 2 Primer sequences used for RT-qPCR

From: Limbal niche cells can reduce the angiogenic potential of cultivated oral mucosal epithelial cells

Name Primer Sequence Size
Rat sFlt-1 Forward CCCTCAGCCTACCATCAAGT 234 bp
Rat Endostatin Forward CCGTGCCCATCGTCAACCT 217 bp
  1. GAPDH: glyceraldehyde 3-phosphate dehydrogenase, bFGF: basic fibroblast growth factor, PEDF: pigment epithelium-derived factor, sFlt-1: soluble fms-like tyrosine kinase-1, VEGF: vascular endothelial growth factor, TSP-1: thrombospondin-1, TIMP-3: tissue inhibitor of metalloproteinase-3