Skip to main content

Advertisement

Table 1 Primer sequences for quantitative real-time polymerase chain reaction

From: Chondrogenic differentiation of bone marrow-derived mesenchymal stem cells following transfection with Indian hedgehog and sonic hedgehog using a rotary cell culture system

Gene Forward primer Reverse primer
IHH CCAACTACAATCCCGACATCATCT CTCGTCCCAGCCTTCAGTCA
SHH CTGACCGTGACCGTAGCAAGT TGGATGTGGGCTTTGGACTCA
Sox9 CTGACCGTGACCGTAGCAAGT TGGATGTGGGCTTTGGACTCA
ANCN ATGGCTTCCACCAGTGCG CGGATGCCGTAGGTTCTCA
collagen II GCTCCCAGAACATCACCTACCA ATTCCTGCTCAGGCCCTCC
collagen X CCCTTCTGCTGCTAGTGTC GTCTTGGTGTTGGGTTGT
Runx2 CCTTCCACTCTCAGTAAGAAGA TAAGTAAAGGTGGCTGGATAGT
annexin V GCAGAACTAACAGCCATAA AGAACCACCAACATCCTC
Beta-2-microglobulin AACGTGGAACAGTCAGACC AGTAATCTCGATCCCATTTC