Skip to main content

Advertisement

Table 1 Primer sequences used for qPCR analyses of gene mRNAs

From: Melatonin receptor depletion suppressed hCG-induced testosterone expression in mouse Leydig cells

Gene name GenBank Accession Primer sequences (5′-3′) Product length
Gapdh NM_001289726 TCACTGCCACCCAGAAGA GACGGACACATTGGGGGTAG 185 bp
MTNR1A NM_008639 TGTCAGCGAGCTGCTCAATG GGTACACAGACAGGATGACCA 158 bp
MTNR1B NM_145712 GAACAGCTCAATCCCTAACTGC ACGACTACTGTAGATAGCATGGG 135 bp
p450scc NM_001346787 AGGTCCTTCAATGAGATCCCTT TCCCTGTAAATGGGGCCATAC 137 bp
p450c17 NM_007809 GCCCAAGTCAAAGACACCTAAT GTACCCAGGCGAAGAGAATAGA 159 bp
StAR NM_011485 TGTCAAGGAGATCAAGGTCCTG CGATAGGACCTGGTTGATGAT 334 bp
Chop NM_007837 AGCTGGAAGCCTGGTATGAGGA AGCTAGGGACGCAGGGTCAA 134 bp
Grp78 NM_001163434 AGAAACTCCGGCGTGAGGTAGA TTTCTGGACAGGCTTCATGGTAG 176 bp
ATF4 NM_009716 CTCTTGACCACGTTGGATGAC CAACTTCACTGCCTAGCTCTAAA 226 bp
XBP1 NM_013842 TGAGTCCGCAGCAGGTG GACAGGGTCCAACTTGT 130 bp
IRE1 AF071777 GTGGTCTCCTCTCGGGTTC CCGTCCCAGGTAGACACAAAC 111 bp
p53 NM_011640 TACAAGAAGTCACAGCACAT GATAGGTCGGCGGTTCAT 267 bp
Caspase-3 NM_001284409 TGACTGGAAAGCCGAAACTC GCAAGCCATCTCCTCATCAG 101 bp
Bcl-2 NM_009741 CGAGAAGAAGGGAGAATCACAGG AATCCGTAGGAATCCCAACC 133 bp