Skip to main content

Advertisement

Table 1 Primer sequences used for qPCR analyses of gene mRNAs

From: Melatonin receptor depletion suppressed hCG-induced testosterone expression in mouse Leydig cells

Gene name GenBank Accession Primer sequences (5′-3′) Product length
Gapdh NM_001289726 TCACTGCCACCCAGAAGA
GACGGACACATTGGGGGTAG
185 bp
MTNR1A NM_008639 TGTCAGCGAGCTGCTCAATG
GGTACACAGACAGGATGACCA
158 bp
MTNR1B NM_145712 GAACAGCTCAATCCCTAACTGC
ACGACTACTGTAGATAGCATGGG
135 bp
p450scc NM_001346787 AGGTCCTTCAATGAGATCCCTT
TCCCTGTAAATGGGGCCATAC
137 bp
p450c17 NM_007809 GCCCAAGTCAAAGACACCTAAT
GTACCCAGGCGAAGAGAATAGA
159 bp
StAR NM_011485 TGTCAAGGAGATCAAGGTCCTG
CGATAGGACCTGGTTGATGAT
334 bp
Chop NM_007837 AGCTGGAAGCCTGGTATGAGGA
AGCTAGGGACGCAGGGTCAA
134 bp
Grp78 NM_001163434 AGAAACTCCGGCGTGAGGTAGA
TTTCTGGACAGGCTTCATGGTAG
176 bp
ATF4 NM_009716 CTCTTGACCACGTTGGATGAC
CAACTTCACTGCCTAGCTCTAAA
226 bp
XBP1 NM_013842 TGAGTCCGCAGCAGGTG
GACAGGGTCCAACTTGT
130 bp
IRE1 AF071777 GTGGTCTCCTCTCGGGTTC
CCGTCCCAGGTAGACACAAAC
111 bp
p53 NM_011640 TACAAGAAGTCACAGCACAT
GATAGGTCGGCGGTTCAT
267 bp
Caspase-3 NM_001284409 TGACTGGAAAGCCGAAACTC
GCAAGCCATCTCCTCATCAG
101 bp
Bcl-2 NM_009741 CGAGAAGAAGGGAGAATCACAGG
AATCCGTAGGAATCCCAACC
133 bp