Skip to main content

Table 1 Primer sequences

From: Curcumin suppresses epithelial-to-mesenchymal transition of peritoneal mesothelial cells (HMrSV5) through regulation of transforming growth factor-activated kinase 1 (TAK1)

Genes Forward primer Reverse primer
α-SMA (122 bp) CTATGAGGGCTATGCCTTGCC GCTCAGCAGTAGTAACGAAGGA
E-cadherin (109 bp) ATTTTTCCCTCGACACCCGAT TCCCAGGCGTAGACCAAGA
Collagen I (119 bp) GTGCGATGACGTGATCTGTG CGGTGGTTTCTTGGTCGGT
Fibronectin (130 bp) CGGTGGCTGTCAGTCAAAG AAACCTCGGCTTCCTCCATAA
TGF-β1 (209 bp) CTAATGGTGGAAACCCACAACG TATCGCCAGGAATTGTTGCTG
GAPDH (282 bp) GAGATCCCTCCAAAATCAAGTG GAGTCCTTCCACGATACCAAAG