Skip to main content

Table 1 Name and sequences of the primers

From: MiR-214 prevents the progression of diffuse large B-cell lymphoma by targeting PD-L1

NamePrimer sequences
 miR-214F: 5′ – CAATACTGACAGCAGGCACA – 3′
R: 5′ – TATGGTTGTTCACGACTCCTTAC – 3′
 U6F: 5′ – CTCGCTTCGGCAGCACA – 3′
R: 5′ – AACGCTTCACGAATTTGCGT – 3′
 PD-L1F: 5′ – GGTGAGGATGGTTCTACACAG – 3′
R: 5′ – GAGAACTGCATGAGGTTGC – 3′
 GAPDHF: 5′ – GGAGCGAGATCCCTCCAAAAT – 3′
R: 5′ – GGCTGTTGTCATACTTCTCATGG – 3’
  1. F: Forward primer; R: Reverse primer