Skip to main content

Table 1 Primer sequences

From: Cellular hypoxia promotes osteogenic differentiation of mesenchymal stem cells and bone defect healing via STAT3 signaling

Gene Acc. No Primer sequence (5′ → 3′) Size (bp)
Hif-1α NM_176958 F: GTCCCAGCTACGAAGTTACAGC 136
R: CAGTGCAGGATACACAAGGTTT  
Alp NM_001081082 F: GGCCATCTAGGACCGGAGA 79
R: TGTCCACGTTGTATGTCTTGG  
Opn NM_001204203 F: ATCTCACCATTCGGATGAGTCT 79
R: TGTAGGGACGATTGGAGTGAAA  
Runx2 NM_001146038 F: GACTGTGGTTACCGTCATGGC 84
R: ACTTGGTTTTTCATAACAGCGGA  
Col1α1 NM_007742 F: GCTCCTCTTAGGGGCCACT 91
R: ATTGGGGACCCTTAGGCCAT  
Osx NM_146065 F: ATCATTGCAGATCAAACGCCT 135
R: AGCACCCTTTTTCTCATCGTC  
Ocn NM_031368 F: CACTCCTCGCCCTATTGGC 112
R: CCCTCCTGCTTGGACACAAAG’  
Opn NM_026493 F: GAAGAGCAAAAAGCGAAACTGG 153
R: TTGGCTGCTTGGTGGAATGT  
Vegf NM_005429 F: GAGGAGCAGTTACGGTCTGTG 96
R: TCCTTTCCTTAGCTGACACTTGT  
Gapdh NM_008085 F: AATGGATTTGGACGCATTGGT 213
R: TTTGCACTGGTACGTGTTGAT