Skip to main content

Table 2 Primer sequences for real-time PCR

From: Targeting the 4-1BB costimulatory molecule through single chain antibodies promotes the human T-cell response

Gene Primer sequence
Forward Reverse
IL-2 ATGTACACCATGCAACTCCTGTCT GTCAGTGTTGAGATGATGCTTTGA
IL-4 GCCTCACAGAGCAGAAGAACAC GTTGGCTTCCTTCACAGGACAG
IFN-γ GGGTTCTCTTGGCTGTTACT GAGTTCCATTATCCGCTACATCT
HPRT AATTATGGACAGGACTGAACGTCTTGCT TCCAGCAGGTCAGCAAAGAATTTATAGC