Fig. 4From: Apoptosis-promoting properties of miR-3074-5p in MC3T3-E1 cells under iron overload conditionsSmad4 mRNA and protein were decreased in MC3T3-E1 cells under iron overload and were inversely correlated with miR-3074-5p expression. A Bioinformatics analysis showed that miR-3074-5p might bind to 3ʹUTR region of Smad4. B MC3T3-E1 cells were transfected with the miR-3074-5p inhibitor and NC separately and treated with or without 1.8 mM FAC. Smad4 mRNA was quantified by qRT-PCR. C Cells were transfected with the miR-3074-5p mimic and NC separately and treated with or without 1.8 mM FAC. Smad4 mRNA was quantified by qRT-PCR. *P < 0.05 vs. the NC group. #P < 0.05 vs. the NC + FAC group. D MC3T3-E1 cells were transfected with miR-3074-5p mimic, miR-3074-5p inhibitor and negative control separately and treated with or without 1.8 mM FAC. Smad4 protein was detected by qRT-PCR. E The dual-luciferase report assay demonstrated that miR-3074-5p directly targets the 3ʹUTR of Smad4. The miR-3074-5p mimic repressed the activity of the wild-type (WT) Smad4 3ʹ-UTR (5ʹ…CUGUCAUGAGUGGAGCAGGAAG…3ʹ), but not that of the mutant type (MT) Smad4 3ʹ-UTR (5ʹ…CUGUCAUGAGUGGAGCUCCAAG…3ʹ). *P < 0.05 vs. the NC groupBack to article page