Skip to main content

Table 1 Sequences of primers used during real-time PCR reactions

From: Primary high-grade serous ovarian cancer cells are sensitive to senescence induced by carboplatin and paclitaxel in vitro

Gene Forward Reverse
ANG1 GCCTACACTTTCATTCTTCCAGA TCTTCCTTGTGTTTTCCTTCCAT
CCL11 CCCTTCAGCGACTAGAGAGC CAGCTTTCTGGGGACATTTG
CXCL12 GTGCCCTTCAGATTGTAGCC CCTTCCCTAACACTGGTTTCA
IL-6 AAAGAGGCACTGGCAGAAAA AGCTCTGGCTTGTTCCTCAC
PDGF-D CCCAGGAATTACTCGGTCAA ACAGCCACAATTTCCTCCAC
TIMP3 CTTCCAAGAACGAGTGTCT GGTCTGTGGCATTGATGA
tPA GACGTGGGAGTACTGTGATGTG CCCTCCTTTGATGCGAAACTGA
TSP-1 GGCAAGGACTGCGTTGGT CACTTCACGCCGGCAAAG
TGF-β1 CAGCAACAATTCCTGGCGATACC GCGCTAAGGCGAAAGCCCTCAAT
VEGF ATCTTCAAGCCATCCTGTGTGC GCTCACCGCCTCGGCTTGT
GAPDH* TCAAGATCATCAGCAATGCC CGATACCAAAGTTGTCATGGA
  1. *GAPDH was used as the reference gene