Skip to main content

Table 1 Sequences of primers used for real-time PCR

From: Changes in expression of cartilaginous genes during chondrogenesis of Wharton’s jelly mesenchymal stem cells on three-dimensional biodegradable poly(L-lactide-co-glycolide) scaffolds

Gene Primer sequences Accession no. Amplicon length (bp)
GAPDH 5’ GAAGGTGAAGGTCGGAGTC 3’ NM_002046.3 226
5’ GAAGATGGTGATGGGATTTC 3’
Collagen type I 5’ CCACCAATCACCTGCGTACA 3’ NM_000088 119
5’ CATCGCACAACACCTTGCC 3’
Collagen type II 5’ TGCTGACGCTGCTCGTCGC 3’ NM_001844.4 163
5’ TCGTCGCAGAGGACAGTCCCA 3’
Collagen type III 5’ CAGCAGGGTGCAATCGGCAGT 3’ NM_000090 177
5’ TGGTTGCCCTGGGTGGCCT 3’
Aggrecan 5’ CAAGAGCAGTGCAATCGTTGG 3’ NM_001135.2 127
NM_013227.2
5’ ACATTCAGCTGCGGTTCCG 3’