Skip to main content

Table 1 Primer sequences used in real-time PCR

From: Ectopic expression of TWIST1 upregulates the stemness marker OCT4 in the esophageal squamous cell carcinoma cell line KYSE30

  Forward primer Reverse primer
TWIST1 GGAGTCCGCAGTCTTACGAG TCTGGAGGACCTGGTAGAGG
OCT4 CCTGAAGCAGAAGACGATCA CCGCAGCTTACACATGTTCT
GAPDH GGAAGGTGAAGGTCGGAGTCA GTCATTGATGGCAACAATATCCAC