Skip to main content

Table 1 Primers for detecting miR-96 and miR-26a based on the stemloop method

From: Platelets activated by the anti-β2GPI/β2GPI complex release microRNAs to inhibit migration and tube formation of human umbilical vein endothelial cells

Primer name Primer sequence
miR-26a-F CCGGuucaaguaauccagga
miR-96-F CCGGuuuggcacuagcacauu
cel-miR-46*-F CCGGaagagagccgucuauu
miR-26a-R CGTATCCAGTGCGTGTCGTG
miR-96- R CGTATCCAGTGCGTGTCGTG
cel-miR-46*- R CGTATCCAGTGCGTGTCGTG
miR-26a- Loop-RT-Primer GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC agccta
miR-96- Loop-RT-Primer GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC agcaaa
cel-miR-46*- Loop-RT-Primer GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGAC actgtc