Isolation of peripheral blood mononuclear cells
Human peripheral blood mononuclear cells (PBMCs) were prepared as previously described [9]. PBMCs were isolated from 10 mL of venous blood using a Ficoll-Paque PLUS centrifuge as previously described [10]. After centrifugation, cells were collected from the interphase layer and washed four times with RPMI 1640 medium. PBMCs (1 × 107 cells/mL) were suspended in RPMI 1640 supplemented with 10% (v/v) and FBS was used to induce the generation of dendritic cells.
Isolation of primary monocytes from PBMCs
Monocytes from Ficoll-isolated PBMCs were resuspended in PBS and incubated in CD14 microbeads for 15 min at 4 °C. The microbead-labeled cells were then resuspended in PBS after centrifugation and isolated by an MS column. The cells labeled with microbeads were washed from the column with PBS; the resultant cells were CD14+ monocytes.
Induction of dendritic cells from monocytes
Dendritic cells were generated from monocytes in the presence of GM-CSF (50 ng/ml) and IL-4 (100 ng/ml). The cells were cultured for six days in RPMI1640 growth medium supplemented with 10% FBS. Maturation of dendritic cells was promoted with stimulation by 1 μg/ml LPS for 24 h.
Flow cytometry
Cell-surface molecule expression of the cultured dendritic cells was evaluated by flow cytometry (FC500, Beckman Coulter), using the following fluorochrome-labeled antibodies: mouse anti-human CD86 FITC (BD Pharmingen) and mouse anti-Human CD83 APC (eBioscience). CXP software from Beckman Coulter was used for the analyses.
Co-culture of HepG2.2.15 and dendritic cells
The co-culture of HepG2.2.15 and dendritic cells was conducted in a transwell system (Corning). HepG2.2.15 cells were seeded in plate and dendritic cells were grown in inserts. The ratio of HepG2.2.15 to dendritic cells was 2.8:1. Both were maintained in RPMI1640 medium supplemented with 10% FBS.
Real-time PCR
Total RNA extraction was performed using TRIzol reagent (Life Technologies) according to the manufacturer’s instructions. Two micrograms of total RNA extracted from dendritic cells was subjected to reverse transcription (RT). The cDNA was synthesized using a one-step RT-PCR kit from Takara. SYBR Green (Toyobo) RT-PCR amplification and real-time fluorescence detection were performed using an ABI 7300 real-time PCR thermal cycle instrument (ABI, USA), according to the supplied protocol. The relative gene expression was calculated by the ∆∆Ct method and the relative expression levels were normalized to that of endogenous GAPDH. The primers used were as follows: H-TLR9-F: CGGTTTGATCTGGCTGGACT, H-TLR9-R: AGGCCAGGTAATTGTCACGG; H-SOCS3-F: TGGTCACCCACAGCAAGTTT, H-SOCS3-R CTGTCGCGGATCAGAAAGGT; and Lnc-DC-F: CAGCCTTCCTCCTCCTGTGA, Lnc-DC-R: CAGCCTTCCTCCTCCTGTGA.
Western blotting
A total of 2 μg of cell lysate was loaded into each lane of a 10% polyacrylamide gel, then blotted onto a polyvinylidene difluoride (PVDF) membrane. After blocking with PBST containing 5% nonfat dry milk, the membrane was incubated with specific primary antibodies against p-Stat3, Stat3, TLR9, and SOCS3. All antibodies were purchased from Cell Signaling Technologies. Peroxidase-linked IgG (Life Technologies) was used as the secondary antibody. These proteins were visualized with an ECL western blotting detection kit (Amersham Biosciences).
Viral production and infection
A lentivirus expressing Lnc-DC-shRNA (shLnc-DC) was produced and purified using the BLOCK-iT Inducible H1 Lentiviral RNAi System (Life Technologies). An shRNA with a scramble sequence was used to generate the control virus. All the manufacturer’s procedures were strictly followed. Dendritic cells in each well were infected with 2 × 106 pfu of virus. The analysis was conducted three days after infection.
MTT assay
MTT was used to evaluate the proliferation of dendritic cells after the downregulation of Lnc-DC. Briefly, cells were incubated with MTT for at least 4 h to produce formazan. When the formazan was completely dissolved by SDS-HCl, the absorbance was measured at 570 nm with a Universal Microplate Reader (Bio-Tek instruments), and OD (MLB-treated group)/OD (blank control group) was calculated.
Analysis of cell cycle phase by flow cytometry
Forty-eight hours following infection with lenti-shLnc-DC, dendritic cells were resuspended in PBS twice before fixation by dropwise addition to 95% precooled ethanol. Prior to analysis, the cells were warmed, centrifuged at 450 g for 5 min, resuspended twice in PBS, then stained with propidium iodide PI (containing RNase A at 50 μg/ml) at room temperature in the dark for 30 min. The DNA content was analyzed by flow cytometry using the CellQuest program (Becton-Dickinson).
Annexin V/7-AAD staining
Cells were washed twice with staining buffer, and then resuspended in Annexin V binding buffer. FITC-Annexin V and the 7-AAD staining solution were added and incubated with cells for 15 min at room temperature in the dark. We used 488 nm excitation and measured the fluorescence emission near 530 nm (FITC channel) for Annexin V and > 670 nm (PE channel) for 7-AAD by flow cytometry.
Enzyme-linked immunosorbent assay
The inflammatory factors in the cell culture supernatant after Lnc-DC silencing were detected by an ELISA kit with quantitative measurements, according to the manufacturer’s recommendations. The inflammatory factors included TNF-α, IL-1β, IL-6, IL-12, and IFN-γ (CUSABIO).
Statistical analysis
All data were presented as mean ± SD. The band density in the western blot analysis was measured with Image J software (NIH). Statistical significance was determined by unpaired Student’s t-test using SigmaPlot Software (Systat Software, San Jose, CA, USA). A value of p < 0.05 was considered to be significant.
