Human subjects
Our study included 64 patients with HCC who were admitted to Third Affiliated Hospital of Sun Yat-Sen University between May 2016 and July 2018. All patients were diagnosed using pathological examinations. Biopsies of tumor tissue and adjacent healthy tissue (within 2 cm of the tumors) were obtained from each patient. All tissues were assessed by 3 experienced pathologists. Inclusion criteria were: 1) first-time diagnosis; 2) complete medical record; 3) willingness to join the study. Exclusion criteria were: 1) presence of other diseases, such as liver and chronic diseases; 2) treatment for HCC before admission; 3) refusal to provide liver biopsies. There were 39 males and 25 females. The age range was 35 to 66 years, with a mean age of 46.1 ± 4.9 years. There were 10 cases of stage I, 12 cases of stage II, 11 cases of stage III and 31 cases of stage IV. This study passed the review of the Ethics Committee of The Third Affiliated Hospital of Sun Yat-Sen University. All participants signed informed consent.
Quantitative RT-PCR
To detect the expression of MIR4435-2HG, total RNA was extracted using an MPure Total RNA Extraction Kit (117,022,160, MP Biomedicals). Reverse transcription was performed using a gb Reverse Transcription Kit (Generi Biotech). PCR systems were prepared using a Luna Universal One-Step RT-qPCR Kit (NEB). To detect the expression of miRNA-487a, an miRNeasy Mini Kit (QIAGEN) was used to extract miRNA. A TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) was used to perform reverse transcription and a miScript SYBR Green PCR Kit (QIAGEN) was used to prepare PCR systems. Primers of MIR4435-2HG, miRNA-487a and the endogenous controls β-actin and U6 were synthesized at Sangon. Using the 2-ΔΔCT method, the expression of MIR4435-2HG was normalized to β-actin and the expression of miRNA-487a was normalized to U6.
Cell lines and cell transfection
Our study included two HCC cell lines: SNU-398 and SNU-182. Cells of these two lines were bought from the American Type Culture Collection (ATCC) and cultivated under the conditions recommended by the ATCC. Vectors expressing MIR4435-2HG, empty vectors, the hsa-miR-487a mimic (AAUCAUACAGGGACAUCCAGUU) and the negative control miRNA were purchased from Sangon. The hsa-miR-487a inhibitor and miRNA inhibitor negative control were purchased from ABM. Lipofectamine 3000 reagent (Thermo Fisher Scientific) was used to perform all cell transfections, with all operations performed according to the manufacturer’s instructions. The treatment regime was 10 mM vectors and 45 mM miRNA. Control cells were only treated with lipofectamine 3000 reagent. Negative control cells were transfected with empty vectors, negative control miRNA or miRNA inhibitor.
Cell proliferation assay
The expressions of MIR4435-2HG and miR-487a were checked 24 h after transfection. Cell proliferation was determined using a Cell Counting Kit-8 kit (Dojindo Molecular Technologies, Inc.) For cells with 200% overexpression of MIR4435-2HG and miR-487a and cells with miR-487a knockdown, where its expression was 50%. Briefly, cells were collected to prepare cell suspensions. The cell density was adjusted to 3 × 104 cells/ml and was transferred to a 96-well plate with 100 μl in each well. Cells were cultivated in an incubator (5% CO2, 37 °C), and 10 μl CCK-8 was added to each well after 24, 48, 72 and 96 h. OD values at 450 nm were measured to represent cell proliferation.
Statistical analysis
All experiments in this study were performed in triplicate. Data are expressed as means ± SD. Comparisons of MIR4435-2HG and miRNA-487a expression between tumor and healthy tissues were performed using the paired t test. Comparisons among 3 groups were performed using one-way ANOVA and Tukey test. Correlations between expression levels of MIR4435-2HG and miRNA-487a were performed using Pearson’s correlation coefficient. Differences with p < 0.05 were statistically significant.
