- Research Article
- Open access
- Published:
Methylated lncRNAs suppress apoptosis of gastric cancer stem cells via the lncRNA–miRNA/protein axis
Cellular & Molecular Biology Letters volume 29, Article number: 51 (2024)
Abstract
Background
Long noncoding RNAs (lncRNAs) play essential roles in the tumorigenesis of gastric cancer. However, the influence of lncRNA methylation on gastric cancer stem cells (GCSCs) remains unclear.
Methods
The N6-methyladenosine (m6A) levels of lncRNAs in gastric cancer stem cells were detected by methylated RNA immunoprecipitation sequencing (MeRIP-seq), and the results were validated by MeRIP-quantitative polymerase chain reaction (qPCR). Specific sites of m6A modification on lncRNAs were detected by single-base elongation- and ligation-based qPCR amplification (SELECT). By constructing and transfecting the plasmid expressing methyltransferase-like 3 (METTL3) fused with catalytically inactivated Cas13 (dCas13b) and guide RNA targeting specific methylation sites of lncRNAs, we obtained gastric cancer stem cells with site-specific methylation of lncRNAs. Reverse transcription (RT)-qPCR and Western blot were used for detecting the stemness of treated gastric cancer stem cells.
Results
The site-specific methylation of PSMA3-AS1 and MIR22HG suppressed apoptosis and promoted stemness of GCSCs. LncRNA methylation enhanced the stability of PSMA3-AS1 and MIR22HG to suppress apoptosis of GCSCs via the PSMA3-AS1–miR-411-3p– or MIR22HG–miR-24-3p–SERTAD1 axis. Simultaneously, the methylated lncRNAs promoted the interaction between PSMA3-AS1 and the EEF1A1 protein or MIR22HG and the LRPPRC protein, stabilizing the proteins and leading to the suppression of apoptosis. The in vivo data revealed that the methylated PSMA3-AS1 and MIR22HG triggered tumorigenesis of GCSCs.
Conclusions
Our study revealed the requirement for site-specific methylation of lncRNAs in the tumorigenesis of GCSCs, contributing novel insights into cancer development.
Background
Cancer has been a hot topic in biological investigations for decades. Regarding the origin of cancer, two hypotheses have been proposed [1]. The gene mutation theory posits that the accumulation of mutations in cancer-related genes triggers tumorigenesis [2, 3]. Another hypothesis, which suggests that tumorigenesis results from the infinite proliferation of cancer stem cells, has become the dominant doctrine in recent years [4]. Cancer stem cells (CSCs), a subclass of neoplastic cells within tumors, possess the ability to self-renew and undergo aberrant differentiation [5]. Over the past decades, there has been an increasing interest in cancer stem cells, because CSCs are not only responsible for tumor initiation, propagation, and maintenance, but also contribute to chemotherapy resistance and relapse of tumors [5, 6]. Therefore, exploring the factors that affect the biological activities especially the differentiation of CSCs becomes urgently required. It is found that some signaling pathways, such as the Hedgehog, Notch, Wnt/β-catenin, and NF-κB, contribute to the enhancement of the self-renewal and differentiation abilities of CSCs [7]. The dysregulation of the genes of these signaling pathways has great effects on cancer stem cells. Long noncoding RNAs (lncRNAs), acting as regulatory factors in gene expression, play pivotal roles in the cellular activities of CSCs [8,9,10]. However, the epigenetic regulatory mechanisms of RNAs, especially lncRNAs, have not been extensively explored.
In recent years, RNA modification, one of the epigenetic regulatory mechanisms of RNAs, has attracted more and more attention [11, 12]. It is found that N6-methyladenosine (m6A) reversible modification plays essential roles in post-transcriptional and translational regulation [13]. In mammals, the formation and removal of m6A of RNA occurs by the m6A methyltransferases called “writers” and demethylases called “erasers” during transcription, respectively, which rely on the m6A-binding proteins called “readers” in either nucleus or cytoplasm [14]. Generally, most m6A modification of mRNAs is installed by m6A methyltransferase complex composed of METTL3, METTL14, and WTAP [15]. METTL16 and METTL5 may function as the m6A “writers” of some noncoding RNAs [16, 17]. Both alkylation repair homolog protein 5 (ALKBH5) and fat-mass and obesity-associated protein (FTO) are well-documented m6A “erasers” [18, 19]. The “readers” of m6A RNA mainly include YTH (YT521-B homology) domain-containing family protein 1 (YTHDF1), YTHDF2, YTHDF3, YTH domain-containing protein 1 (YTHDC1), YTHDC2, and insulin-like growth factor 2 mRNA-binding proteins (IGF2BPs) [20, 21]. As reported, m6A modification has significant effects on the stemness maintenance and differentiation of stem cells and cancer stem cells [22,23,24]. However, the m6A modification of lncRNAs and its impact on CSCs remain unexplored.
To address this issue, the differences of lncRNA m6A modification between gastric cancer stem cells (GCSCs) and gastric cancer nonstem cells (GCNSCs), which were isolated from patients with gastric cancer (GC), was characterized in this study. The findings unveiled that the site-specific m6A modification of lncRNAs PSMA3-AS1 and MIR22HG promotes tumorigenesis in GCSCs by suppressing apoptosis and promoting proliferation through increased stability of miRNAs and proteins..
Methods
Sorting and culture of GCSCs and GCNSCs
GCSCs were sorted from the solid tumors of a patient with GC. The solid tumors were washed by phosphate buffered saline (PBS) and were subsequently sliced into 1 mm3 fragments. Following this, they were subjected to a 5 h digestion using collagenase I (Gibco). The mixture was filtrated through a 200 mesh filter and then centrifuged at 100 × g for 10 min. Then the cell suspension was cultured in serum-free Dulbecco’s modified Eagle's medium (DMEM)/F12 medium (Gibco) containing 2% B27 (Invitrogen), 5 μg/ml insulin (Sigma), 20 ng/ml basic fibroblast growth factor (bFGF; FSigma), 20 ng/ml epidermal growth factor (EGF; Sigma), and 1% penicillin–streptomycin solution (Gibco). After culture for 1 week, the cells derived from tumorspheres were identified as GCSCs. Tumorsphere formation assay and western blotting for stemness gene were used for identification of the separated GCSCs. The residual cells, which failed to form tumorspheres were regarded as GCNSCs and cultured in DMEM basic medium (Gibco) with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin–streptomycin solution (Gibco).
Isolation of stem cells from the GC cell lines HGC-27 and MGC-803 has been described in our previous report [25]. Briefly, ALDEFLUOR Kit (Cyagen) was employed to isolate GCSCs, which was based on the expression of ALDH1, a recognized marker for GCSCs. Cells suspended in buffer with ALDH1 fluorescent substrate BODIPY-aminoacetate (BAAA, 1 μmol/L) or diethylaminobenzaldehyde (DEAB), a specific inhibitor of ALDH1, were subjected to fluorescence activated cell sorting (FACS).
Western blot
Proteins was released using lysis buffer with protease inhibitors, and were then loaded onto sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels for separation. Next, the proteins were transferred onto a nitrocellulose membrane, which was successively blocked with 5% nonfat milk. Incubation with primary antibodies (Abcam) against the target proteins overnight at 4 °C, followed by washing and incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch). The chemiluminescence signal was examined using ECL kit (PerkinElmer).
Tumorsphere formation assay
A single cell was cultured in a 96-well ultra-low attachment microplate (Corning) for 15 days, and the status of cells was recorded by light microscope. At various time points after culture, the percentage of tumorsphere formation was calculated.
Methylated RNA immunoprecipitation sequencing (MeRIP-seq)
After removal of rRNAs by RiboMinus™ Eukaryote Kit v2 (Invitrogen), total RNAs were interrupted into ~ 100 nt by RNA fragmentation reagents (Invitrogen). Subsequently the RNAs were incubated with anti-m6A antibody (Abcam) and Protein A/G Magnetic Beads (Thermo Scientific) at 4 ℃ overnight. The RNA fragments bound with beads were eluted and subjected to RNA sequencing or reverse transcription-quantitative polymerase chain reaction (RT-qPCR).
Transwell migration assay
Cell migration was assessed using a Transwell® 24-well Permeable Support (Corning, USA). Cells were seeded in serum-free medium and cultured for 24 h. Then, 5 × 104 cells were placed into the upper chamber of the Transwell insert (8.0 µm pore size). The lower chamber was filled with medium containing 20% serum as a chemoattractant. After incubation at 37 °C for 24 h, cells that had not migrated through the pores were removed from the upper side of the Transwell membrane with a cotton swab. The cells on the lower side of the membrane were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and then imaged using a light microscope. Migrated cells were quantified by counting the cells in five fields per membrane under 10 × magnification, and the mean number of cells was calculated.
Detection of chemoresistance of cancer cells
Chemoresistance of cancer cells was assessed using MTT assay. Briefly, cells were seeded into 96-well plates and cultured overnight. The following day, cells were treated with cisplatin at different final concentrations (10, 25, 50, and 100 μg/mL). After 48 h of treatment, cell viability was assessed according to the protocol of the cell viability assay. The half maximal inhibitory concentration (IC50) values were calculated from the dose–response curves for each cell line.
Silencing and rescue of gene expression
To knockdown METTL3 or METTL14 in cells, shRNAs (METTL3-shRNA, 5′-CGTCAGTATCTTGGGCAAGTT-3′; METTL14- shRNA, 5′-GCCGTGTTAAATAGCAAAGAT-3′) were cloned into pLVX-shRNA2 lentiviral vector. Then the recombinant vector was cotransfected with psPAX2 and pMD2.G into HEK293T cells using Lipofectamine 2000 (Invitrogen) to package the virus. At 48 h later, the viral suspension was collected for transfection into GCSCs. At 24 h after infection, GCSCs were screened by puromycin (0.5 μg/mL).
To rescue the expression of METTL3 or METTL14 in the METTL3-silenced or the METTL14-silenced stem cells, the METTL3 gene or the METTL14 gene was amplified using primers (METTL3, 5′-CCCAAGCTTTTCGAGAGGTGTCAGGGCTGGG-3′ and 5′-GCGG CCGCTAAACTATCAGAGCCATGGCTATGGATTCT; METTL14, 5′-CCCAAGC TTTCTGTTCGTAAGCTCCCGGTGA-3′ and 5′-GGATCCCGACAACTGCAAGC AAGGCTCGCT-3′) and inserted into pcDNA3.1 + vector. To avoid the targeting of recombinant METTL3 or METTL14 by METTL3-shRNA or METTL14-shRNA, the METTL3 gene or the METTL14 gene was mutated from C to T at position 1278 or from C to T at position 254. Then METTL3-knockdown or /METTL14-knockdown GCSCs were subjected to transfection with the recombinant plasmids.
To silence the expressions of PSMA3-AS1, MIR22HG, AP1G1, SERTAD1, EEF1A1, and LRPPRC, GCSCs were transfected with siRNAs (PSMA3-AS1-siRNA, 5′-GCAAAAATGCAAAATACCAGG-3′; MIR22HG-siRNA, 5′-ATATAAACATTACAGGCTGGG-3′; AP1G1-siRNA, 5′-TTGCGAGTCCTAGCCATAATT-3′; SERTAD1-siRNA, 5′-TATGTATGACAATGAA CTTTT-3′; EEF1A1-siRNA, 5′-CCAGAAGAGATATGAGGAATT-3′; LRPPRC- siRNA, 5′-CACCTTATGGACCGTGATTTT-3′). As a control, control siRNA (5′-T TCTCCGAACGTGTCACGTTT-3′) was also transfected into GCSCs.
Quantitative real-time PCR
RNAs were extracted from either cells or the MeRIP products using Trizol extraction (TransGen). Subsequently, cDNA was synthesized using a reverse transcription system (Vazyme). qPCR was performed using SYBR Green PCR Master Mix (Vazyme) with primers (PAPPA-AS1, 5′-AGCCTCTTTTGCCTAATATCCTT-3′ and 5′-GCCACAGAAGAACCTTACCAG-3′; PSMA3-AS1, 5′-CTTGTCGGCGCCATTTTGTC-3′ and 5′-GGCCGCACAAAAACCAATCT-3′; MIR22HG, 5′-AGCGGACGCAGTGATTTGCT-3′ and 5′-TGGCAGCTTTAGCTGGGTCA-3′; LINC00342, 5′-ACTACAGTGGCAGACAGACC-3′ and 5′-CAGCCCAACTTTCTTTACTGTGTT-3′; LINC01410, 5′-CAAGAATGGCCCAAGCAGTC-3′ and 5′-CCCTCCTAGGTCCTGGTTGT-3′; LINC00680, 5′-AGTTGTTTGGGCTGTCGCT-3′ and 5′-GGGGGCAAGGCAAATCAATAC-3′; miR-101-3p, 5′-GCCGAGTACAGTACTGTGATA-3′ and 5′-CTCAACTGGTGTCGTGGA-3′; miR-4429, 5′-GCCGAGAAAAGCTGGGCT-3′ and 5′- CTCAACTGGTGTCGTGGA-3′; miR-411-3p, 5’-GCCGAGTATGTAACACGGTC-3′ and 5′- CTCAACTGGTGTCGTGGA-3′; miR-24-3p, 5′-GCCGAGTGGCTCAGTTCAGCA-3′ and 5′-CTCAACTGGTGTCGTGGA-3′; TRPC4AP, 5′-TGTCCATCCTGTTGAACCCG-3′ and 5′-CCTGTACCCAAAGACCTGGG-3′; SERTAD1, 5′-GGGTCATAGCTTGGGCTGTT-3′ and 5′- AGCAGCACACGGATTTGAGA-3′; AP1G1, 5′-TGCTTGCGCATTTCAGAAAGAA-3′ and 5′-CGTACCTGCAAAAAGGGGTC-3′; EEF1A1, 5′-TTTTCGCAACGGGTTTGCC-3′ and 5′-GATGGCCAGTAGTGGTGGAC-3′; LRPPRC, 5′-AGTGAAAGCATTCGCGGAGA-3′ and 5′-TTCATGGCCAATGCCTGGAT-3′; GAPDH, 5′-GGACCTGACCTGCCGTCTAG-3′ and 5′-GTAGCCCAGGATGCCCTTGA-3′; U6, 5′-CTCGCTTCGGCAGCACA-3′ and 5′-AACGCTTCACGAATTTGCGT). Expression data were consistently standardized to the internal control GAPDH or U6 and the relative abundance of RNA were assessed by the △△Ct method.
Examination of lncRNA stability
To assess the stability of lncRNAs, cells were exposed to actinomycin D (Sigma) at a final concentration of 80 nM. Cells were collected at different time points (0, 2, 4, 8, and 12 h) after treatment, followed by total RNA extraction and RT-qPCR.
Site-specific methylation of lncRNAs in cells
Site-specific methylation of lncRNAs in cells was performed as described before [26]. Briefly the DNA fragment encoding the guide RNA targeting A1225 of PSMA3-AS1 (5′-TACAGGTTATCTCAGAATATCTTTTTTGGC-3′) or A2041 of MIR22HG (5′-ATATTGGGTCTTATTTTTTTCTGTTATGGT-3′) was inserted into pC0043-PspCas13b crRNA backbone (Addgene). Subsequently the recombinant pC0043-PspCas13b crRNA backbone was cotransfected with the plasmid expressing METTL3 fused with catalytically inactivated Cas13 (dCas13b; Addgene) into cells (106/well) using Lipofectamine 2000 (Invitrogen). The cells were cultured in Opti-MEM I Reduced Serum Media (Gibco). The cells were harvested 36 h post-transfection.
Dot blot
Total RNAs extracted were heated at 98 °C for 3 min. After being chilled on ice immediately thereafter, RNAs were dropped onto a nitrocellulose membrane, followed by crosslink under ultraviolet. The membrane was incubated with blocking buffer (PBS, 0.02% Tween-20, 5% milk, pH7.4) for 1 h at room temperature. Successively, anti-m6A antibody was incubated with the membrane overnight at 4 °C. After washing with PBST, the membrane was incubated with the HRP-conjugated secondary antibody. The signals were examined using ECL kit (PerkinElmer).
Dual-luciferase reporter assay
The recombinant pmirGLO vector inserted fragments of lncRNAs and synthesized miRNAs (GenePharma) were transfected together into GCSCs using Lipofectamine 2000. The scrambled sequence of a miRNA was used as a control. The luciferase activities were measured using the dual luciferase reporter assay kit (Vazyme) at 36 h post transfection.
RNA pulldown assay
The biotin-labeled lncRNA probe (PSMA3-AS1, 5’- TACAAAATCCATCTGCT GACCCCTG-biotin-TEG-3′; MIR22HG, 5′-TCTCTACCACTGTCCCACACGCATC-biotin-TEG-3′; biotin-TEG, biotin with 15 atom triethylene glycol spacer) was synthesized by Hangzhou Youkang Biotechnology Inc. The lncRNA-biotin probe was incubated with streptavidin magnetic beads (Beyotime) in 1 × Binding & washing buffer (10 mM Tris–HCl, 1 mM EDTA, 2 M NaCl, 0.01–0.1% Tween-20, pH 7.5) for 30 min at room temperature. Then the lysate of cells were incubated with washed beads in for 2 h at 4 °C. Subsequently, miRNAs or proteins were extracted from the beads. The miRNA extraction was performed using mirVana miRNA Isolation Kit (Thermo Fisher Scientific) and analyzed by qPCR. The proteins were eluted using 0.1% SDS, followed by SDS-PAGE. Mass spectrometry was used for identification of binding proteins.
Cell viability assay
At various time points posttreatment, cells were collected by centrifuging. Next, collected cells were exposed to CellTiter 96® AQueous reagent (Promega, USA) and incubated at 37 °C for 2 h. The iMark Microplate Absorbance Reader (Bio-Rad) was used for detection of the absorbance of cells.
Cell cycle analysis
Cells were incubated with prechilled 70% ethanol at 4 °C for 30 min, and then incubated with RNase A (Beyotime) at 37 °C for 20 min. Finally, incubation with PI (Yeasen) at 37 °C for 10 min was used for cell staining. The fluorescence intensity was measured using flow cytometry.
Caspase 3/7 activity assays
1 × 106 cells were exposed to 100 μL Caspase-Glo® 3/7 reagent according to the instruction of the Caspase-Glo® 3/7 Assay (Promega). After incubating at room temperature for 2 h, Glomax system (Promega) was used to examining the luminescence of cells.
Tumorigenicity assay in vivo
GCSCs with the site-specific methylation of PSMA3-AS1 or MIR22HG were constructed and then injected into mice. The guide RNA targeting PSMA3-AS1 (5′-G TACAGGTTATCTCAGAATATCTTTTTTGGC-3′) or MIR22HG (5′-GATATTGG GTCTTATTTTTTTCTGTTATGGT-3′) was cloned into the pLVX-IRES-Neo lentiviral vector (Addgene) behind the cPPT site. METTL3 was also cloned into the lentiviral vector as a fusion protein of Cas13b. The recombinant lentiviral vector was transfected into HEK293T cells to package the virus. At 48 h later, the viral suspension was collected for transfection into METTL3-silenced GCSCs and cultured for 24 h. The cells were then screened using G418 sulfate (Thermofisher) for 24 h. The living cells were collected and cultured for 48 h. Subsequently, 1 × 106 cells were mixed with matrigel and subcutaneously injected into five female BALB/c mice at a volume of 100 μL per mouse. After 4 weeks, the mice were sacrificed and the solid tumors were dissected for subsequent use.
Statistical analysis
All experiments were replicated a biological minimum of three times. One-way analysis of variation (ANOVA) and Student’s t-test were used to analyze the numerical data.
Results
N6-methyladenosine lncRNAs in GCSCs
To reveal the relationship between the stemness of GCSCs and m6A modification of lncRNAs, the m6A-modified lncRNAs of GCSCs sorted from the solid tumors of a GC patient were characterized. The results indicated a tumorsphere formation rate of 97.9% for the identified potential GCSCs, whereas no tumorspheres were observed in the case of the GCNSCs (Fig. 1A). Correspondingly, a single cell from a tumorsphere of potential GCSCs had the capability to form another tumorsphere (Fig. 1B). Western blot analysis demonstrated a notable upregulation of some stemness genes in GCSCs (Fig. 1C). The migration efficiency and the chemoresistance capacity of GCSCs were significantly increased compared with those of GCNSCs (Fig. 1D and E). These data confirmed a successful isolation of GCSCs from solid tumors.
The results of dot blot using m6A-specific antibody revealed a considerably elevated m6A level in RNAs within GCSCs compared with GCNSCs (Fig. 1F), suggesting that the m6A modification of RNAs play a crucial role in GCSCs. Therefore, the m6A-modified lncRNAs of GCSCs were sequenced. On the basis of MeRIP-seq, the m6A level of 128 lncRNAs were elevated in GCSCs, yet the m6A level of 1 lncRNA was decreased in GCSCs (Fig. 1G). The MeRIP-seq data showed that the m6A levels of six lncRNAs (PAPPA-AS1, PSMA3-AS1, MIR22HG, LINC00342, LINC01410, and LINC00680) were significantly upregulated in GCSCs compared with those in GCNSCs (Fig. 1G). To confirm the expression profiles of the methylated lncRNAs in GCSCs, the m6A levels of these six lncRNAs were analyzed by MeRIP-qPCR. The results indicated that the six lncRNAs were significantly upregulated in GCSCs compared with the control (Fig. 1H), confirming the MeRIP-seq data.
Collectively, the findings unveiled a substantial increase in m6A levels of lncRNAs within GCSCs compared with those in GCNSCs, implying the essential roles of m6A modification of lncRNAs in GCSCs.
Mechanism of lncRNA methylation in GCSCs
To elucidate the function of methylated lncRNAs in GCSCs, the GCSCs were further sorted from HGC-27 and MGC-803. Using flow cytometry, we sorted ALDH1-positive cells from HGC-27 and MGC-803, and the tumorsphere formation assay demonstrated that a tumorsphere could be formed by a single cell derived from the sorted ALDH1-positive cells of HGC-27 or MGC-803 (Fig. 2A). Meanwhile, Western blot analysis showed that the genes related to stemness were upgraded in the ALDH1-positive cells (Fig. 2B). The capacities of migration and chemoresistance of the ALDH1-positive cells were significantly increased compared with those of the control (Fig. 2C, D). These results showed a successful isolation of GCSCs from HGC-27 and MGC-803.
To reveal the mechanism of lncRNA methylation in GCSCs, the enzymes responsible for lncRNA methylation, including METTL3 and METTL14, the key methyltransferases for the m6A modification of mRNAs and lncRNAs, were characterized in GCSCs, GCSC-HGC, and GCSC-MGC. Western blot analysis revealed a substantial upregulation of METTL3 and METTL14 in three distinct GCSC types (Fig. 2E), suggesting the significant roles of METTL3 and METTL14 in the GCSCs.
To investigate the impact of METTL3/METTL14 on lncRNA methylation in GCSCs, sequence-specific shRNA (METTL3/METTL14-shRNA) was employed to knock down METTL3/METTL14 in three GCSC types. Additionally, the silenced METTL3/METTL14 was rescued (METTL3/METTL14-shRNA rescue) in the METTL3/METTL14-silenced GCSCs, and subsequent examination focused on lncRNA methylation. The results of western blot demonstrated the successful silencing or rescue of METTL3/METTL14 in all three GCSC types (Fig. 2F, I). The silence of METTL3/METTL14 caused a reduction of m6A level of lncRNAs, including MIR22HG, LINC00342, PSMA3-AS1, LINC01410, PAPPA-AS1, and LINC00680, in GCSCs, while METTL3/METTL14-shRNA rescue repaired the discrepancy of m6A level in lncRNAs (Fig. 2G, J).
To evaluate the impact of METTL3/METTL14 on GCSCs, the protein levels of stemness genes were assessed in GCSCs with METTL3/METTL14-shRNA or METTL3/METTL14-shRNA rescue by western blot analysis. The findings demonstrated a significant reduction in protein levels of those genes in GCSCs with METTL3/METTL14-shRNA, whereas the expression levels of those genes in the METTL3/METTL14-shRNA rescued GCSCs were similar to those of the controls (Fig. 2H, K). These findings suggested that METTL3/METTL14 enhanced the stemness of GCSCs.
In summary, METTL3 and METTL14 have demonstrated their crucial roles in lncRNA methylation of GCSCs, which could promote the stemness of GCSCs.
Roles of methylated lncRNAs in GCSCs
On the basis of the MeRIP-Seq data, six lncRNAs (PAPPA-AS1, PSMA3-AS1, MIR22HG, LINC00342, LINC01410, and LINC00680) had a high m6A level in GCSCs. To further elucidate the functions of methylated lncRNAs in GCSCs, the expression profiles of six lncRNAs were investigated. The results showed that two lncRNAs (PSMA3-AS1 and MIR22HG) were substantially elevated in all GCSCs compared with the corresponding GCNSCs (Fig. 3A), suggesting the crucial roles played by these lncRNAs in GCSCs.
To evaluate the impact of lncRNAs on GCSCs, PSMA3-AS1 or MIR22HG was knocked down in GCSCs, followed by examining the stemness of knockdown GCSCs. The RT-qPCR data demonstrated that PSMA3-AS1 and MIR22HG were respectively silenced in three types of GCSCs (Fig. 3B). The silencing of PSMA3-AS1 or MIR22HG caused a significant downregulation of the stemness markers in GCSCs (Fig. 3C), showing the important roles of PSMA3-AS1 or MIR22HG in GCSCs. And the results of the cell viability assay showed that the PSMA3-AS1 or MIR22HG downregulation significantly reduced the viability of GCSCs (Fig. 3D). The suppression of GCSCs’ viability mediated by the PSMA3-AS1 or MIR22HG silencing resulted from cell cycle arrest in the G0/G1 phase, subsequently leading to apoptosis of GCSCs (Fig. 3E, F). These findings indicated that PSMA3-AS1 and MIR22HG exert positive influences on GCSCs.
To investigate the impact of m6A modification on lncRNAs in GCSCs, we initially predicted the m6A sites within the lncRNAs PSMA3-AS1 and MIR22HG by SRAMP (http://www.cuilab.cn/sramp). The analysis revealed the presence of 12 potential m6A sites in PSMA3-AS1 and 10 in MIR22HG (Fig. 3G). According a previous report, single-base elongation- and ligation-based qPCR amplification analysis (SELECT) was performed to determine the m6A sites of lncRNAs [27].The data of qPCR analysis confirmed that 11 and 8 of the predicted m6A sites of PSMA3-AS1 and MIR22HG were methylated in GCSCs, respectively (Additional file 1: Fig. S1A). Among the m6A sites of lncRNAs, the N6-methyladenosine modification level at position 1225 of PSMA3-AS1 (m6A1225) or at position 2041 of MIR22HG (m6A2041) was significantly increased in GCSCs compared with GCNSCs (Fig. 3H), implying that the site-specific methylated adenosine of PSMA3-AS1 and MIR22HG play a significant role in GCSCs.
To elucidate the impact of the site-specific m6A modification of lncRNAs on GCSCs, the A1225 site of PSMA3-AS1 and the A2041 site of MIR22HG were specifically methylated in the METTL3-silenced GCSCs and then the methylation on those lncRNAs were confirmed (Fig. 3I). Meanwhile, the results of the cell viability assay indicated that silencing of METTL3 obviously impaired the viability of GCSCs, while the methylation of A1225 of PSMA3-AS1 (METTL3-shRNA + methylated PSMA3-AS1) or A2041 of MIR22HG (METTL3-shRNA + methylated MIR22HG) significantly increased the viability of METTL3-silenced GCSCs compared with METTL3-silenced GCSCs (METTL3-shRNA) (Fig. 3J), implying that the site-specific m6A modification of lncRNAs could promote the proliferation of GCSCs. The data of cell cycle analysis revealed that GCSCs with METTL3-shRNA induced cell cycle arrest in G1/G0 phase, and the methylation of A1225 of PSMA3-AS1 or A2041 of MIR22HG recovered the cell cycle of GCSCs (Fig. 3K). Correspondingly, the METTL3 knockdown-mediated cell cycle arrest activated apoptosis of GCSCs, whereas the apoptotic activity of METTL3-silenced GCSCs with the methylation of A1225 of PSMA3-AS1 (METTL3-shRNA + methylated PSMA3-AS1) or A2041 of MIR22HG (METTL3-shRNA + methylated MIR22HG) was commensurate with that of the control (METTL3-shRNA-scrambled; Fig. 3L). Evidently, the site-specific m6A modification of lncRNAs was required for the proliferation of GCSCs.
Furthermore, the western blots analysis revealed a significant elevation of stemness in METTL3-silenced GCSCs with methylation of the A1225 site of PSMA3-AS1 or the A2041 site of MIR22HG (Fig 3M). Consistently, the methylation of PSMA3-AS1 or MIR22HG significantly promoted the tumorsphere formation of the METTL3-silenced GCSCs (Fig 3N and O). These data unveiled a positive contribution of lncRNA methylation to stemness of GCSCs.
Together, these data demonstrated that site-specific m6A modification of lncRNAs (PSMA3-AS1 and MIR22HG) was required for the proliferation of GCSCs via suppressing apoptosis and promoting the stemness of GCSCs.
Influence of m6A modification on the stability of lncRNAs
To investigate the effect of m6A modification on lncRNA stability, the RNA levels of PSMA3-AS1 and MIR22HG in METTL3-silenced GCSCs were determined. A considerable decrease of the RNA levels of PSMA3-AS1 and MIR22HG were exhibited in METTL3-silenced GCSCs (Fig. 4A), intimating that m6A modification could enhance the stability of lncRNAs.
To further validate the influence of m6A modification on lncRNAs stability, the METTL3-silenced GCSCs were exposed to actinomycin D, followed by the assessment of lncRNAs enrichment. The findings indicated elevated expression levels of PSMA3-AS1 and MIR22HG in METTL3-silenced GCSCs treated with actinomycin D than those in GCSCs (Fig. 4B). It can be inferred that m6A modification could stabilize PSMA3-AS1 and MIR22HG in GCSCs.
Underlying mechanism of lncRNAs in GCSCs
Generally, lncRNAs function by binding to miRNAs. On the basis of literature and prediction using ENCORI and DIANA-LncBase, the potential miRNAs targeted by PSMA3-AS1 or MIR22HG were obtained (Additional file 1: Table S1). The results of lncRNA pulldown assays showed that miR-101, miR-4429, and miR-411-3p were notably enriched in the pulled down RNAs using PSMA3-AS1, while miR-24-3p was significantly enriched in the pulled down RNAs using MIR22HG (Fig. 5A). Thereafter, the dual luciferase reporter assays revealed that miR-411-3p or miR-24-3p significantly reduced the luciferase activity of GCSC cotransfected with miR-411-3p and pmirGLO-PSMA3-AS1 or miR-24-3p and pmirGLO-MIR22HG (Fig. 5B), suggesting the direct interaction between miR-411-3p and PSMA3-AS1, in a similar manner to miR-24-3p and MIR22HG.
To elucidate the roles of miR-411-3p and miR-24-3p in GCSCs, we examined the expression profiles of these miRNAs in both GCSCs and GCNSCs. The findings indicated an obvious upregulation of miR-411-3p and miR-24-3p in GCSCs (Fig. 5C), suggesting that these two miRNAs played important roles in GCSCs.
To further explore the roles of the miRNAs interacting with lncRNAs, the potential targets of miRNAs were predicted using microT, miRmap, and TargetScan algorithms. The results showed that four genes were the potential targets of miR-411-3p, while ten genes might be targeted by miR-24-3p (Fig. 5D). To confirm the target genes of miRNAs, the change of expression of target genes were examined after transfecting with miR-411-3p or miR-24-3p in GCSC. Upon overexpression of miR-411-3p or miR-24-3p in GCSC (Fig. 5E), the expression level of AP1G1 or TRPC4AP and SERTAD1 was substantially diminished (Fig. 5F), implying that miR-411-3p or miR-24-3p might target AP1G1 or TRPC4AP and SERTAD1. And the dual luciferase assays were performed and the data demonstrated that AP1G1 or SERTAD1 was the gene targeted by miR-411-3p or miR-24-3p (Fig. 5G).
To explore whether the target genes of miRNAs had effects on GCSCs, the expression levels of AP1G1 and SERTAD1 in GCSCs and GCNSCs were assessed. The findings indicated a remarkable upregulation of AP1G1 and SERTAD1 in GCSCs (Fig. 5H and I), suggesting that AP1G1 and SERTAD1 might play essential roles in GCSCs. The AP1G1 or SERTAD1 silencing induced apoptosis of GCSC (Fig. 5J) and downregulated the protein abundance of stemness genes in GCSC (Fig. 5K), showing that AP1G1 and SERTAD1 were required for shaping GCSC characteristics. As reported, AP1G1 and SERTAD1 promote gastric cancer progression [28, 29]. In this context, AP1G1 and SERTAD1 could promote tumorigenesis of GCSCs.
The m6A sites of lncRNAs PSMA3-AS1 and MIR22HG were far from the base sequences bound to the seed sequences of miRNAs. Thus, the m6A modification of lncRNAs did not affect the interaction between PSMA3-AS1 and miR-411-3p, similarly to MIR22HG and miR-24-3p. To assess whether PSMA3-AS1 or MIR22HG functioned as a ceRNA, the expression profiles of AP1G1 or SERTAD1 were determined in the PSMA3-AS1 or MIR22HG-silenced GCSCs. The findings revealed that the PSMA3-AS1 or MIR22HG silencing noticeably decreased the expression level of miRNA-targeted mRNA of AP1G1 or SERTAD1 (Fig. 5L and M), indicating that lncRNAs PSMA3-AS1 and MIR22HG functioned as ceRNAs in GCSCs.
Collectively, these findings demonstrated that lncRNA PSMA3-AS1 or MIR22HG promoted the stemness of GCSCs via the PSMA3-AS1–miR-411-3p–AP1G1 or MIR22HG– and miR-24-3p–SERTAD1 axis.
Interactions between m6A-modified lncRNAs and proteins
To reveal the proteins that interacted with lncRNAs, lncRNA pulldown assays were performed. The results exhibited that a specific protein from GCSCs, identified to be EFF1A1 or LRPPRC, was bound to PSMA3-AS1 or MIR22HG (Fig. 6A). However, the protein level from the METTL3-silenced GCSCs was lower than that from GCSCs (Fig. 1A), connoting that the methylation of PSMA3-AS1 or MIR22HG affected the EFF1A1–PSMA3-AS1 and LRPPRC–MIR22HG interactions. Western blots confirmed the interaction between EFF1A1 and PSMA3-AS1 or LRPPRC and MIR22HG and the lncRNA–protein interaction was weakened by lncRNA demethylation (Fig. 6B). These data indicated that lncRNA methylation promoted the interaction between lncRNA and protein.
To unveil the impact of lncRNA methylation on the proteins bound to lncRNAs, protein stability was detected and the findings showed that PSMA3-AS1 or MIR22HG silencing decreased the EFF1A1 or LRPPRC protein level in GCSCs compared with the controls (Fig. 6C). However, PSMA3-AS1 or MIR22HG silencing had no impact on the EFF1A1 or LRPPRC mRNA level (Fig. 6C). These data demonstrated that the methylation of lncRNAs enhanced the stability of the proteins bound to PSMA3-AS1 or MIR22HG.
To investigate the roles of EEF1A1 and LRPPRC in GCSCs, the differential expression of EEF1A1 or LRPPRC in GCSCs and GCNSCs was evaluated. The results showed that at both RNA and protein levels, abundance of EEF1A1 and LRPPRC were considerably elevated in GCSCs (Fig. 6D), suggesting that EEF1A1 and LRPPRC played important roles in GCSCs. To reveal the function of EEF1A1 and LRPPRC in GCSCs, EEF1A1 and LRPPRC were knocked down in GCSCs (Fig. 6E). EEF1A1 or LRPPRC silencing led to the inhibition of GCSCs’ viability (Fig. 6F) and caused cell cycle arrest in G0/G1 phase of GCSCs, which triggered apoptosis of GCSCs (Fig. 6G, H). Consistently, the expression of stemness genes were impaired in EEF1A1-silenced or LRPPRC-silenced GCSCs (Fig. 6I). These data revealed the influential role of EEF1A1 and LRPPRC in maintaining stemness and proliferation of GCSCs.
Taken together, these results implied that the methylated PSMA3-AS1 or MIR22HG was interacted with EFF1A1 or LRPPRC protein to enhance the protein stability, leading to the suppression of apoptosis and the promotion of stemness of GCSCs.
Influence of m6A modification of lncRNAs on tumorigenesis of GCSCs in vivo
To investigate the influence of methylated PSMA3-AS1 and MIR22HG on tumorigenesis of GCSCs in vivo, METTL3-silenced GCSC with or without the m6A modification of PSMA3-AS1 or MIR22HG were injected into BALB/c mice (Fig. 7A). The tumor volume exhibited a more rapid growth in the mice injected with METTL3-silenced GCSCs containing the methylated PSMA3-AS1 or MIR22HG than mice without the lncRNA methylation (Fig. 7B). Uniformly, much bigger and heavier tumors were developed in the mice with methylated PSMA3-AS1 or MIR22HG (Fig. 7C and D). Thus, it can be inferred that m6A modification of PSMA3-AS1 or MIR22HG prominently contributes to the promotion of tumorigenesis in GCSCs in vivo.
Then m6A level of lncRNAs were detected for confirming the methylation of lncRNAs in solid tumors (Fig. 7E). To assess the function of lncRNA methylation on solid tumors, the apoptosis and proliferation of solid tumors were examined using immunohistochemical analysis. The immunohistochemical analysis data exhibited that Caspase 3 was dramatically reduced in the solid tumors of mice with methylated PSMA3-AS1 or MIR22HG, whereas Ki67 was upregulated (Fig. 7F), implying that the methylation of lncRNAs promoted tumor growth by suppressing apoptosis in vivo. Furthermore, the expression of stemness genes in the tumors of mice with the treatment of methylated PSMA3-AS1 or MIR22HG were upregulated (Fig. 7G). These results illustrated the positive contribution of lncRNA methylation to tumor progression in vivo.
In conclusion, these results underscore the potential of m6A modification in lncRNAs (PSMA3-AS1 and MIR22HG) to drive tumorigenesis in GCSCs through both miRNA-mediated and protein-mediated pathways (Fig. 7H).
Discussion
The dysregulation of lncRNAs has been increasingly recognized as a significant contributor to tumorigenesis [30]. Although the precise mechanisms through which lncRNAs exert their functions are still being elucidated, it is established that lncRNAs play a role in modulating gene expression at diverse levels [31, 32]. Comprehending the complex interplay between lncRNAs and tumorigenesis is essential for unraveling the underlying mechanisms driving cancer progression [32]. Owing to the importance of lncRNAs, the epigenetic modifications of lncRNAs, including RNA methylation, have emerged as crucial mechanisms modulating lncRNAs’ roles in tumorigenesis, shedding light on the regulatory approaches that contribute to cancer pathogenesis [33, 34]. The methylation of lncRNAs, specifically m6A, is a prominent posttranscriptional modification of lncRNAs [33, 34]. Accumulating evidence highlights the profound influence of m6A modification of lncRNAs on the regulation of the stability, subcellular localization, and interactions with miRNAs and RNA-binding proteins [33, 34]. The m6A modification of lncRNAs can facilitate the recognition by specific reader proteins, leading to either enhanced or reduced stability, thereby shaping lncRNA abundance and availability [35]. The m6A modification landscape can impact the transport and spatial distribution of lncRNAs within distinct cellular compartments, orchestrating their interactions with target genes or proteins [35]. However, the involvement of m6A modification in lncRNA-mediated tumorigenesis remains largely unexplored. In this study, based on the global screening and characterization of the methylated lncRNAs in GCSCs, the site-specific m6A modification was found in two lncRNAs PSMA3-AS1 and MIR22HG of GCSCs. The methylated PSMA3-AS1 and MIR22HG, which were upregulated in GCSCs sorted from the solid tumors of a patient with gastric cancer and two distinct gastric cancer cell lines (HGC-27 and MGC-803), suppressed apoptosis and promoted the stemness of three types of GCSCs, thus promoting tumorigenesis. In this context, our findings revealed the requirement of the site-specific methylation of lncRNAs in tumorigenesis, shedding light on potential therapeutic targets for gastric cancer treatment.
Numerous studies have provided compelling evidence to demonstrate the popular roles of lncRNAs as ceRNAs in cancer development [36]. In this study, the results indicated that the site-specific m6A modification of PSMA3-AS1 and MIR22HG enhanced the stability of lncRNAs in GCSCs, thus having a promotive role on PSMA3-AS1 and MIR22HG as ceRNAs in tumorigenesis of gastric cancer. Accordingly, our discoveries unveiled an innovative mechanism of lncRNA-mediated ceRNAs. In our study, it was found that the methylated but not the unmethylated PSMA3-AS1 or MIR22HG could interact with EEF1A1 or LRPPRC protein in GCSCs. As reported, lncRNAs can exhibit diverse functional roles in the process of interactions with proteins, acting as protein decoys to recruit or sequester proteins, or functioning as scaffolds to facilitate the assembly of protein complexes [37, 38]. Our study revealed that lncRNA methylation facilitated the interaction between lncRNA and protein to increase protein stability and further promoted tumorigenesis of GCSCs. In this context, our discoveries provide novel insights into the methylation of lncRNAs, emphasizing the significance of m6A modification in tumorigenesis of GCSCs. It should be noted that the mechanism was validated in three gastric cancer cell lines, including one sample from a patient with gastric cancer and two different typical gastric cancer cell lines. Given the heterogeneity of cancer cells, the conclusions we summarized require further validation with additional samples from patients with gastric cancer. In addition to gastric cancer, the roles of methylated PSMA3-AS1 and MIR22HG in other cancers merits further exploration in future.
Conclusions
Our findings demonstrated that the methylation level of PSMA3-AS1 and MIR22HG, mediated by METTL3 and METTL14, was significantly elevated in GCSCs. This study revealed that the site-specific m6A modification of PSMA3-AS1 and MIR22HG suppressed apoptosis and promoted the stemness of GCSCs. LncRNA methylation increased the stability of PSMA3-AS1 and MIR22HG to promote proliferation and suppress apoptosis of GCSCs via the PSMA3-AS1–miR-411-3p–AP1G1 or MIR22HG–miR-24-3p–SERTAD1 axis. At the same time, the methylation of PSMA3-AS1 or MIR22HG promoted the interaction between PSMA3-AS1 and EEF1A1 protein or MIR22HG and LRPPRC and stabilized the interacted proteins, leading to the suppression of apoptosis and the promotion of proliferation of GCSCs.
Availability of data and materials
All data generated or analyzed during this study are included in this published article and its Additional information files.
Abbreviations
- lncRNAs:
-
Long noncoding RNAs
- GCSCs:
-
Gastric cancer stem cells
- GCNSCs:
-
Gastric cancer non-stem cells
- NF-κB:
-
Nuclear factor kappa-light- chain-enhancer of activated B cells
- m6A:
-
N6-methyladenosine
- METTL3:
-
Methyltransferase-like 3
- WTAP:
-
Wilms tumor 1 associated protein
- ALKBH5:
-
Alkylation repair homolog protein 5
- FTO:
-
Fat-mass and obesity-associated protein
- YTHDF1:
-
YTH (YT521-B homology) domain-containing family protein 1
- YTHDC1:
-
YTH domain-containing protein 1
- IGF2BPs:
-
Insulin-like growth factor 2 mRNA-binding proteins
References
Ganesh K, Massague J. Targeting metastatic cancer. Nat Med. 2021;27(1):34–44.
Mouw KW, Goldberg MS, Konstantinopoulos PA, D’Andrea AD. DNA damage and repair biomarkers of immunotherapy response. Cancer Discov. 2017;7(7):675–93.
Baslan T, Hicks J. Unravelling biology and shifting paradigms in cancer with single-cell sequencing. Nat Rev Cancer. 2017;17(9):557–69.
Ayob AZ, Ramasamy TS. Cancer stem cells as key drivers of tumour progression. J Biomed Sci. 2018;25(1):20.
Batlle E, Clevers H. Cancer stem cells revisited. Nat Med. 2017;23(10):1124–34.
Lytle NK, Barber AG, Reya T. Stem cell fate in cancer growth, progression and therapy resistance. Nat Rev Cancer. 2018;18(11):669–80.
Galoczova M, Coates P, Vojtesek B. STAT3, stem cells, cancer stem cells and p63. Cell Mol Biol Lett. 2018;23(1):12.
Wang Y, He L, Du Y, Zhu P, Huang G, Luo J, et al. The long noncoding RNA lncTCF7 promotes self-renewal of human liver cancer stem cells through activation of wnt signaling. Cell Stem Cell. 2015;16(4):413–25.
Zhan Y, Chen Z, He S, Gong Y, He A, Li Y, et al. Long non-coding RNA SOX2OT promotes the stemness phenotype of bladder cancer cells by modulating SOX2. Mol Cancer. 2020;19(1):25.
Zhou X, Gao Q, Wang J, Zhang X, Liu K, Duan Z. Linc-RNA-RoR acts as a “sponge” against mediation of the differentiation of endometrial cancer stem cells by microRNA-145. Gynecol Oncol. 2014;133(2):333–9.
Arango D, Sturgill D, Alhusaini N, Dillman AA, Sweet TJ, Hanson G, et al. Acetylation of cytidine in mRNA promotes translation efficiency. Cell. 2018;175(7):1872-1886.e24.
Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012;485(7397):201–6.
Zaccara S, Ries RJ, Jaffrey SR. Reading, writing and erasing mRNA methylation. Nat Rev Mol Cell Biol. 2019;20(10):608–24.
Fu Y, Dominissini D, Rechavi G, He C. Gene expression regulation mediated through reversible m 6 A RNA methylation. Nat Rev Genet. 2014;15(5):293–306.
Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, et al. A METTL3–METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat Chem Biol. 2014;10(2):93–5.
van Tran N, Ernst FGM, Hawley BR, Zorbas C, Ulryck N, Hackert P, et al. The human 18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112. Nucleic Acids Res. 2019;47(15):7719–33.
Dai YZ, Liu YD, Li J, Chen MT, Huang M, Wang F, et al. METTL16 promotes hepatocellular carcinoma progression through downregulating RAB11B-AS1 in an m6A-dependent manner. Cell Mol Biol Lett. 2022;27(1):41.
Jia G, Fu Y, Zhao X, Dai Q, Zheng G, Yang Y, et al. N6-Methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol. 2011;7(12):885–7.
Zheng G, Dahl JA, Niu Y, Fedorcsak P, Huang CM, Li CJ, et al. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell. 2013;49(1):18–29.
Huang H, Weng H, Sun W, Qin X, Shi H, Wu H, et al. Recognition of RNA N6-methyladenosine by IGF2BP proteins enhances mRNA stability and translation. Nat Cell Biol. 2018;20(3):285–95.
Liao S, Sun H, Xu C. YTH Domain: a family of N 6-methyladenosine (m 6 A) Readers. Genom Proteom Bioinf. 2018;16(2):99–107.
Gu C, Wang Z, Zhou N, Li G, Kou Y, Luo Y, et al. Mettl14 inhibits bladder TIC self-renewal and bladder tumorigenesis through N6-methyladenosine of Notch1. Mol Cancer. 2019;18(1):168.
Zheng Q, Hou J, Zhou Y, Li Z, Cao X. The RNA helicase DDX46 inhibits innate immunity by entrapping m6A-demethylated antiviral transcripts in the nucleus. Nat Immunol. 2017;18(10):1094–103.
Zhu Y, Xiao B, Liu M, Chen M, Xia N, Guo H, et al. N6-methyladenosine-modified oncofetal lncRNA MIR4435-2HG contributed to stemness features of hepatocellular carcinoma cells by regulating rRNA 2′-O methylation. Cell Mol Biol Lett. 2023;28(1):89.
Qi Y, Wei J, Zhang X. Requirement of transcription factor NME2 for the maintenance of the stemness of gastric cancer stem-like cells. Cell Death Dis. 2021;12(10):1–10.
Wilson C, Chen PJ, Miao Z, Liu DR. Programmable m6A modification of cellular RNAs with a Cas13-directed methyltransferase. Nat Biotechnol. 2020;38(12):1431–40.
Xiao Y, Wang Y, Tang Q, Wei L, Zhang X, Jia G. An elongation- and ligation-based qPCR amplification method for the radiolabeling-free detection of locus-specific N 6 -methyladenosine modification. Angew Chem Int Ed. 2018;57(49):15995–6000.
Tao X, Lu Y, Qiu S, Wang Y, Qin J, Fan Z. AP1G1 is involved in cetuximab-mediated downregulation of ASCT2-EGFR complex and sensitization of human head and neck squamous cell carcinoma cells to ROS-induced apoptosis. Cancer Lett. 2017;1(408):33–42.
You J, Liu J, Bao Y, Wang L, Yu Y, Wang L, et al. SEI1 induces genomic instability by inhibiting DNA damage response in ovarian cancer. Cancer Lett. 2017;28(385):271–9.
Bartonicek N, Maag JLV, Dinger ME. Long noncoding RNAs in cancer: mechanisms of action and technological advancements. Mol Cancer. 2016;27(15):43.
Wang KC, Chang HY. Molecular mechanisms of long noncoding RNAs. Mol Cell. 2011;43(6):904–14.
Mattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol. 2023;24(6):430–47.
Ma S, Chen C, Ji X, Liu J, Zhou Q, Wang G, et al. The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 2019;12(1):121.
Yao ZT, Yang YM, Sun MM, He Y, Liao L, Chen KS, et al. New insights into the interplay between long non-coding RNAs and RNA-binding proteins in cancer. Cancer Commun. 2022;42(2):117–40.
Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021;220(2): e202009045.
Khan A, Zhang X. Function of the long noncoding RNAs in hepatocellular carcinoma: classification, molecular mechanisms, and significant therapeutic potentials. Bioengineering. 2022;9(8):406.
Li S, Sun J, Ma J, Zhou C, Yang X, Zhang S, et al. LncRNA LENGA acts as a tumor suppressor in gastric cancer through BRD7/TP53 signaling. Cell Mol Life Sci. 2022;80(1):5.
Li Y, Xia Y, Jiang T, Chen Z, Shen Y, Lin J, et al. Long noncoding RNA DIAPH2-AS1 promotes neural invasion of gastric cancer via stabilizing NSUN2 to enhance the m5C modification of NTN1. Cell Death Dis. 2023;14(4):1–17.
Acknowledgements
Not applicable.
Funding
This work was financially supported by China Ocean Mineral Resources R & D Association (DY135-B-04).
Author information
Authors and Affiliations
Contributions
Yuan Ci designed the work, performed data analysis, investigation, and writing of the original draft; Yuan Zhang performed data curation and provided resources; Xiaobo Zhang performed writing review and editing, supervision, and funding acquisition.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
Gastric cancer stem cells from patients were were acquired in compliance with the Helsinki Declaration and approved by Shandong Cancer Hospital (SDTHEC2021003061) on 4 March 2021. All the animal experiments in this study were performed in accordance with the Basel Declaration and were approved by the Animal Care and Use Committee of Zhejiang University (IACUC-19792) on 21 April 2023.
Consent for publication
My data will be deposited in a publicly accessible database and the accession number will be provided.
Competing interests
The authors declare that they have no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1:
Table S1. Potential miRNAs targeted by lncRNAs. Fig S1. Detection of the predicted m6A sites of lncRNAs PSMA3-AS1 A and MIR22HG B in GCSCs using single-base elongation- and ligation-based qPCR amplification analysis. Total RNAs were extracted form GCSCS and then subjected to single-base elongation- and ligation-based qPCR amplification analysis to evaluate the predicted m6A sites on PSMA3-AS1 (A) or MIR22HG (B). The A232 site with no m6A motif RRACH (R=G/A; H=A/C/U) was used as an input control.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Ci, Y., Zhang, Y. & Zhang, X. Methylated lncRNAs suppress apoptosis of gastric cancer stem cells via the lncRNA–miRNA/protein axis. Cell Mol Biol Lett 29, 51 (2024). https://doi.org/10.1186/s11658-024-00568-8
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s11658-024-00568-8